The promoter region of Pseudomonas putida PRS2000 gene catR was determined by reverse transcriptase mapping. Beta-gal assay of both the catR gene promoter and catBCA operon promoter indicated constitutive autoregulation of catR and inducer-dependent activation of catBCA. CatR was purified via DNA affinity column, and functionality was confirmed by EMSA. Hydroxyl-radical footprinting identified three points of direct contact between the promoter and catR across 24 bp. Footprints were not influence by the presence of the inducer.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
TCCATCAGACCTCCAGGGTATGGT | catB, catC, catA, |
|
activator | not specified |