Curation Information

Publication
The roles of indoleglycerol phosphate and the TrpI protein in the expression of trpBA from Pseudomonas aeruginosa.;Chang M, Crawford IP;Nucleic acids research 1990 Feb 25; 18(4):979-88 [2107533]
TF
TrpI [P11720, view regulon]
Reported TF sp.
Pseudomonas aeruginosa PAO1
Reported site sp.
Pseudomonas aeruginosa PAO1
Created by
Dinara Sagitova
Curation notes
-

Experimental Process

Transcription start sites of divergently transcribed trpBA and trpI were identified by Sl nuclease mapping. DNase I footprinting was used to locate the TrpI binding site. TrpI binding site was further characterized by hydroxyl radical footprinting. Alignment of the trpBA-trpI intergenic regions from P.aeruginosa PAO1 and P.putida PPGI identified the putative consensus sequence of the TrpI binding site.

Transcription Factor Binding Sites


TATTCGTGAGTTTTCCTGACAGGTTGC
TATTCGTGAGTTTTCCTGACAGGTTGC

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
TATTCGTGAGTTTTCCTGACAGGTTGC
... ... trpB trpA trpI PA0038
Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Hydroxyl-radical footprinting (ECO:0005643) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - not specified not specified