Curation Information

Publication
Transcriptional activation of pyoluteorin operon mediated by the LysR-type regulator PltR bound at a 22 bp lys box in Pseudomonas aeruginosa M18.;Li S, Huang X, Wang G, Xu Y;PloS one 2012; 7(6):e39538 [22761817]
TF
PltR [B3G2A3, view regulon]
Reported TF sp.
Pseudomonas aeruginosa M18
Reported site sp.
Pseudomonas aeruginosa M18
Created by
Grace Chandler
Curation notes
-

Experimental Process

Visual inspection of the pltL upstream region identified a putative PltR binding site. A pltL-LacZ fusion demonstrated activation of pltL expression by PltR. EMSA confirmed binding of PltR to the pltL promoter. Site directed mutagenesis in conjunction with EMSA and lacZ fusion assays confirmed the functionality of the proposed binding site.

Transcription Factor Binding Sites


GCCTTTGCGCAGCCGCAAAGGC
GCCTTTGCGCAGCCGCAAAGGC

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
GCCTTTGCGCAGCCGCAAAGGC pltL, pltA, pltB, pltC, pltD, pltE, pltF, pltG,
... ... pltL pltA pltB pltC pltD pltE pltF pltG pltR pltM
Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details Visual sequence inspection (nan) - activator not specified