Visual inspection of the pltL upstream region identified a putative PltR binding site. A pltL-LacZ fusion demonstrated activation of pltL expression by PltR. EMSA confirmed binding of PltR to the pltL promoter. Site directed mutagenesis in conjunction with EMSA and lacZ fusion assays confirmed the functionality of the proposed binding site.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
GCCTTTGCGCAGCCGCAAAGGC | pltL, pltA, pltB, pltC, pltD, pltE, pltF, pltG, |
|
activator | not specified |