Curation Information

Publication: The Pseudomonas aeruginosa lectins PA-IL and PA-IIL are controlled by quorum sensing and by RpoS.;Winzer K, Falconer C, Garber NC, Diggle SP, Camara M, Williams P;Journal of bacteriology 2000 Nov; 182(22):6401-11 [11053384]
TF: LasR [P54292, view regulon]
Reported TF sp.: Pseudomonas aeruginosa PAO1
Reported site sp.: Pseudomonas aeruginosa PAO1
Created by: Dinara Sagitova
Curation notes: -

Experimental Process

LecA transcription start site was determined by primer extension and S1 nuclease analysis. lecA-lux reporter assay results suggested that lecA expression is directly regulated by RhlR. A putative RhlR binding site was verified by multiple sequence alignment with luxI, rhlA, and rhlI and the lasB-OP1 genes.

Transcription Factor Binding Sites

Sites reported in the paper
Sites matched in the genome

TCCTGCATGAATTGGTAGGC

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence	Regulated genes	Gene diagram	Experimental techniques	TF function	TF type
TCCTGCATGAATTGGTAGGC	lecA		Experimental technique details Luciferase reporter assay (ECO:0005648) Luciferase reporter assay - ECO:0005648 A type of reporter assay . The idea is identical to a betagalactosidase assay, but here fluorescence of luciferase gene product is used as the reporter. - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) Multiple sequence alignment (MSA) - ECO:0005556 MSA can be used to align promoter regions and highlight regions of conservation that may be indicative of transcription factor binding sites. -	activator	not specified