Curation Information

Publication: The Pseudomonas aeruginosa rmlBDAC operon, encoding dTDP-L-rhamnose biosynthetic enzymes, is regulated by the quorum-sensing transcriptional regulator RhlR and the alternative sigma factor σS.;Aguirre-Ramírez M, Medina G, González-Valdez A, Grosso-Becerra V, Soberón-Chávez G;Microbiology (Reading, England) 2012 Apr; 158(Pt 4):908-16 [22262098]
TF: LasR [P54292, view regulon]
Reported TF sp.: Pseudomonas aeruginosa PAO1
Reported site sp.: Pseudomonas aeruginosa PAO1
Created by: Dinara Sagitova
Curation notes: -

Experimental Process

rmlBDAC operon transcription start was determined by primer extension analysis. A putative RhlR binding site resembling a las box was identified by visual inspection of the rmlBDAC promoter. rmlBDAC-lacZ fusion assays using rhlR mutant strain showed the expression of the rmlBDAC operon in early stationary phase is dependent on RhlR. Deletion of the putative binding site resulted in lower expression levels in lacZ reporter assays. Site-directed mutagenesis of the RhlR binding site completely abolished the induction of the lacZ promoter fusion by RhlR.

Transcription Factor Binding Sites

Sites reported in the paper
Sites matched in the genome

ACCTACCAGATCTGGGGTTG

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence	Regulated genes	Gene diagram	Experimental techniques	TF function	TF type
ACCTACCAGATCTGGGGTTG	rmlB, rmlD, rmlA, rmlC,		Experimental technique details Beta-gal reporter assay Beta-gal reporter assay Reporter assay using the beta-galactosidase (lacZ) gene. The lacZ gene is typically fused to the promoter of interest. Differential regulation of the promoter mediated by the TF is assessed by induction of the system and evaluation of lacZ expression. Bacteria expressing lacZ appear blue when grown on a X-gal medium. The assay is often performed using a plasmid borne construction on a lacZ(def) strain. - Experimental technique details Site directed mutagenesis (ECO:0005667) Site directed mutagenesis - ECO:0005667 Target-specific mutation, as opposed to non-specific mutation. In the context of TF-binding sites, site-directed mutagenesis is typically used to establish/confirm the specific sequence and location of a site, often in tandem with EMSA. Different positions of a putative binding site are mutated to non-consensus (or random) bases and binding to the mutated site is evaluated through EMSA or other means. Often implemented only in conserved motif positions or serially through all positions of a site. - Experimental technique details Visual sequence inspection (nan) Visual sequence inspection - nan Visual inspection of promoter region to identify putative binding sites based on previous knowledge -	activator	not specified