Curation Information

Publication
Inhibitors of the Pseudomonas aeruginosa quorum-sensing regulator, QscR.;Liu HB, Lee JH, Kim JS, Park S;Biotechnology and bioengineering 2010 May 1; 106(1):119-26 [20091741]
TF
PhzR [G3XD77, view regulon]
Reported TF sp.
Pseudomonas aeruginosa PAO1
Reported site sp.
Pseudomonas aeruginosa PAO1
Created by
Dinara Sagitova
Curation notes
A previously known site was reported in the methods section.

Experimental Process

EMSA confirmed binding of QscR to the PA1897 promoter. Beta-gal reporter assays confirmed QscR-mediated

Transcription Factor Binding Sites


ACCTGCCCGGAAGGGCAGGTTGTCCC
ACCTGCCCGGAAGGGCAGGTTGTCCC

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type