Curation Information

Publication: The iron-sulphur cluster biosynthesis regulator IscR contributes to iron homeostasis and resistance to oxidants in Pseudomonas aeruginosa.;Romsang A, Duang-Nkern J, Leesukon P, Saninjuk K, Vattanaviboon P, Mongkolsuk S;PloS one 2014; 9(1):e86763 [24466226]
TF: IscR [Q9HXI7, view regulon]
Reported TF sp.: Pseudomonas aeruginosa PAO1
Reported site sp.: Pseudomonas aeruginosa PAO1
Created by: Dinara Sagitova
Curation notes: -

Experimental Process

The results of qRT-PCR showed that iscR expression was upregulated under stressful conditions (upon treatment with plumbahin, organic hydroperoxides, dipyridyl, paraquat, menadione, H2O2 and high salt). The transcription start site of the iscR operon was mapped by primer extension. Visual inspection of the sequences upstream of the iscR transcription start revealed two putative type 1 IscR-binding motifs. These two motifs had 68% and 76% identity, respectively, to the consensus sequence for the E. coli type 1 IscR-binding motif. qRT-PCR showed that under uninduced conditions, the expression of iscR in the iscR mutant strain was 20.8-fold higher that in the wild-type PAO1. site-directed mutagenesis of amino acid residues involved in [2Fe-2S] ligation was performed to produce IscR variants. The IscR mutants showed lower levels of siderophore production compared with the strain producing wild-type IscR.

Transcription Factor Binding Sites

Sites reported in the paper
Sites matched in the genome

AATCCTGAGTAATTTGATCGGTCTT
ATAGTTGACCTAATTACTCGGATAA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence	Regulated genes	Gene diagram	Experimental techniques	TF function	TF type
AATCCTGAGTAATTTGATCGGTCTT	iscR,		Experimental technique details qRT-PCR [RNA] (ECO:0001808) qRT-PCR [RNA] - ECO:0001808 Quantitative Reverse-Transcription PCR is a modification of PCR in which RNA is first reverse transcribed into cDNA and this is amplified measuring the product (qPCR) in real time. It therefore allows one to analyze transcription by directly measuring the product (RNA) of a gene's transcription. If the gene is transcribed more, the starting product for PCR is larger and the corresponding volume of amplification is also larger. - Experimental technique details Visual sequence inspection (nan) Visual sequence inspection - nan Visual inspection of promoter region to identify putative binding sites based on previous knowledge -	repressor	not specified
ATAGTTGACCTAATTACTCGGATAA	iscR,		Experimental technique details qRT-PCR [RNA] (ECO:0001808) qRT-PCR [RNA] - ECO:0001808 Quantitative Reverse-Transcription PCR is a modification of PCR in which RNA is first reverse transcribed into cDNA and this is amplified measuring the product (qPCR) in real time. It therefore allows one to analyze transcription by directly measuring the product (RNA) of a gene's transcription. If the gene is transcribed more, the starting product for PCR is larger and the corresponding volume of amplification is also larger. - Experimental technique details Visual sequence inspection (nan) Visual sequence inspection - nan Visual inspection of promoter region to identify putative binding sites based on previous knowledge -	repressor	not specified