A dauB::lacZ fusion assay using an argR dauR mutant identified ArgR-dependent activation of the dauBAR operon. Sequence analysis of the dauB region revealed a potential ArgR binding site. EMSA using purified ArgR and the regulatory region of dauB demonstrated ArgR binding. Site-directed mutagenesis was used to introduce mutations to the putative ArgR binding site. EMSA performed with the mutated dauBAR promoter showed that ArgR binding to this promoter was abolished.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
TGACCGACGGCGGCACCTGCGTGTCGCAGAAACGAAA | dauB, dauA, dauR |
|
activator | not specified |