Curation Information

Publication: Analysis of the Pseudomonas aeruginosa elastase (lasB) regulatory region.;Rust L, Pesci EC, Iglewski BH;Journal of bacteriology 1996 Feb; 178(4):1134-40 [8576049]
TF: LasR [P25084, view regulon]
Reported TF sp.: Pseudomonas aeruginosa PAO1
Reported site sp.: Pseudomonas aeruginosa PAO1
Created by: Matthew Coveyou
Curation notes: -

Experimental Process

Primer extension and S1 protection assay identified the transcription start site of P. aeruginosa PA01 gene lasB, and comparison of the wild-type extension product with the (non-existent) product of the lasR-mutant strain validated lasB up-regulation by lasR. Inspection of the promoter region identified a putative site (OP2) upstream of and similar to one published previously (OP1), both comparable to the V. fischeri lux operator. Beta-gal results of site-directed mutagenesis at positions 3, 5, and 18 in OP1 demonstrated reduced expression (98%, 27%, and ~100% reduction, respectively) with positions 3 (cytosine) and 18 (guanine) critical for expression. Double-point mutation of OP2 resulted in 20% loss of expression, though partial and total deletion assays resulted in 66% and 93% expression loss, respectively.

Transcription Factor Binding Sites

Sites reported in the paper
Sites matched in the genome

ACCTGCCAGTTCTGGCAGGT
ACCTGCTTTTCTGCTAGCT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence	Regulated genes	Gene diagram	Experimental techniques	TF function	TF type
ACCTGCCAGTTCTGGCAGGT	lasB		Experimental technique details Beta-gal reporter assay Beta-gal reporter assay Reporter assay using the beta-galactosidase (lacZ) gene. The lacZ gene is typically fused to the promoter of interest. Differential regulation of the promoter mediated by the TF is assessed by induction of the system and evaluation of lacZ expression. Bacteria expressing lacZ appear blue when grown on a X-gal medium. The assay is often performed using a plasmid borne construction on a lacZ(def) strain. - Experimental technique details Site directed mutagenesis (ECO:0005667) Site directed mutagenesis - ECO:0005667 Target-specific mutation, as opposed to non-specific mutation. In the context of TF-binding sites, site-directed mutagenesis is typically used to establish/confirm the specific sequence and location of a site, often in tandem with EMSA. Different positions of a putative binding site are mutated to non-consensus (or random) bases and binding to the mutated site is evaluated through EMSA or other means. Often implemented only in conserved motif positions or serially through all positions of a site. - Experimental technique details Visual sequence inspection (nan) Visual sequence inspection - nan Visual inspection of promoter region to identify putative binding sites based on previous knowledge -	activator	not specified
ACCTGCTTTTCTGCTAGCT	lasB		Experimental technique details Beta-gal reporter assay Beta-gal reporter assay Reporter assay using the beta-galactosidase (lacZ) gene. The lacZ gene is typically fused to the promoter of interest. Differential regulation of the promoter mediated by the TF is assessed by induction of the system and evaluation of lacZ expression. Bacteria expressing lacZ appear blue when grown on a X-gal medium. The assay is often performed using a plasmid borne construction on a lacZ(def) strain. - Experimental technique details Site directed mutagenesis (ECO:0005667) Site directed mutagenesis - ECO:0005667 Target-specific mutation, as opposed to non-specific mutation. In the context of TF-binding sites, site-directed mutagenesis is typically used to establish/confirm the specific sequence and location of a site, often in tandem with EMSA. Different positions of a putative binding site are mutated to non-consensus (or random) bases and binding to the mutated site is evaluated through EMSA or other means. Often implemented only in conserved motif positions or serially through all positions of a site. - Experimental technique details Visual sequence inspection (nan) Visual sequence inspection - nan Visual inspection of promoter region to identify putative binding sites based on previous knowledge -	activator	not specified