EMSA demonstrated that purified AlgR binds specifically to the algD promoter. DNase I footprinting using a set of deletion constructs of algD concluded that AlgR had at least three binding sites upstream of the algD promoter, with the highest affinity sites very far upstream. DNase I footprinting within the far upstream site (FUS) region localized RB1 and RB2 binding sites.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
TGGCGCTACCGTTCGTCCCTCCG |
|
not specified | not specified | ||
CTCAACCGTTCGTCTGCAAGT |
|
not specified | not specified |