Curation Information

Publication
Antibiotic-dependent induction of Pseudomonas putida DOT-T1E TtgABC efflux pump is mediated by the drug binding repressor TtgR.;TerĂ¡n W, Felipe A, Segura A, Rojas A, Ramos JL, Gallegos MT;Antimicrobial agents and chemotherapy 2003 Oct; 47(10):3067-72 [14506010]
TF
TtgR [Q9AIU0, view regulon]
Reported TF sp.
Pseudomonas putida DOT-T1E
Reported site sp.
Pseudomonas putida DOT-T1E
Created by
Joe Sparenberg
Curation notes
-

Experimental Process

lacZ analysis showed that TtgR is a repressor of the ttgABC operon and the ttgR gene. EMSA showed that TtgR binds specifically to the ttgR-ttgABC intergenic region. DNase I footprinting assays identified the region bound by TtgR in the ttgR-ttgABC intergenic region.

Transcription Factor Binding Sites


TATTTACAAACAACCATGAATGTAAGTATATTC
TATTTACAAACAACCATGAATGTAAGTATATTC

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type