Curation Information

Publication: OxyR regulated the expression of two major catalases, KatA and KatB, along with peroxiredoxin, AhpC in Pseudomonas putida.;Hishinuma S, Yuki M, Fujimura M, Fukumori F;Environmental microbiology 2006 Dec; 8(12):2115-24 [17107553]
TF: OxyR [Q88C74, view regulon]
Reported TF sp.: Pseudomonas putida KT2442
Reported site sp.: Pseudomonas putida KT2442
Created by: Matthew Coveyou
Curation notes: -

Experimental Process

P. putida catalase genes katA and katB were initially selected for study. Catalase activity was monitored in wild-type and oxyR mutant strains, with the mutant strain demonstrating activity 10x in excess of the wild-type. Activity stain gel analysis of katA and katB mirrored these results. The P. putida gene ahpC was selected for investigation when it was determined to share an oxyR-binding motif with katA and katB, based on the E. coli oxyR binding motif. EMSA of katA, katB, and ahpC demonstrated direct binding of oxyR with similar affinity for all three, with specificity confirmed against DNA lacking the proposed binding sites. RT-PCR of katA, katB, and ahpC in oxyR-variable strains was consistent with data from the activity staining gels.

Transcription Factor Binding Sites

Sites reported in the paper
Sites matched in the genome

ATTGTTTATTTCTATTGATGTAAGTCATGTAATGAAT
ACAGAGCCAGCCTATCAGGCTCCAACAGCCACTCTAT
ATAGCCAAAACCAATCGAAAGCATGAGCTTTGCCAAT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence	Regulated genes	Experimental techniques	TF function	TF type
ATTGTTTATTTCTATTGATGTAAGTCATGTAATGAAT	katA	Experimental technique details Ad-hoc quantitative phenotype observation (ECO:0005676) Ad-hoc quantitative phenotype observation - ECO:0005676 A quantifiable phenotypic trait (e.g. glucose intake) is assessed in a quantitative manner after induction of the regulatory mechanism and used as a natural reporter.. The observable phenotypic trait should be described in the experimental notes. - Experimental technique details EMSA (ECO:0001807) EMSA - ECO:0001807 Electro-mobility shift-assays (or gel retardation assays) are a standard way of assessing TF-binding. A fragment of DNA of interest is amplified and labeled with a fluorophore. The fragment is left to incubate in a solution containing abundant TF and non-specific DNA (e.g. randomly cleaved DNA from salmon sperm, of all things) and then a gel is run with the incubated sample and a control (sample that has not been in contact with the TF). If the TF has bound the sample, the complex will migrate more slowly than unbound DNA through the gel, and this retarded band can be used as evidence of binding. The unspecific DNA ensures that the binding is specific to the fragment of interest and that any non-specific DNA-binding proteins left-over in the TF purification will bind there, instead of on the fragment of interest. EMSAs are typically carried out in a bunch of fragments, shown as multiple double (control+experiment) lanes in a wide picture. Certain additional controls are run in at least one of the fragments to ascertain specificity. In the most basic of these, specific competitor (the fragment of interest or a known positive control, unlabelled) is added to the reaction. This should sequester the TF and hence make the retardation band disappear, proving that the binding is indeed specific - Experimental technique details qRT-PCR [RNA] (ECO:0001808) qRT-PCR [RNA] - ECO:0001808 Quantitative Reverse-Transcription PCR is a modification of PCR in which RNA is first reverse transcribed into cDNA and this is amplified measuring the product (qPCR) in real time. It therefore allows one to analyze transcription by directly measuring the product (RNA) of a gene's transcription. If the gene is transcribed more, the starting product for PCR is larger and the corresponding volume of amplification is also larger. - Experimental technique details Visual sequence inspection (nan) Visual sequence inspection - nan Visual inspection of promoter region to identify putative binding sites based on previous knowledge -	repressor	not specified
ACAGAGCCAGCCTATCAGGCTCCAACAGCCACTCTAT	PP_3668,	Experimental technique details Ad-hoc quantitative phenotype observation (ECO:0005676) Ad-hoc quantitative phenotype observation - ECO:0005676 A quantifiable phenotypic trait (e.g. glucose intake) is assessed in a quantitative manner after induction of the regulatory mechanism and used as a natural reporter.. The observable phenotypic trait should be described in the experimental notes. - Experimental technique details EMSA (ECO:0001807) EMSA - ECO:0001807 Electro-mobility shift-assays (or gel retardation assays) are a standard way of assessing TF-binding. A fragment of DNA of interest is amplified and labeled with a fluorophore. The fragment is left to incubate in a solution containing abundant TF and non-specific DNA (e.g. randomly cleaved DNA from salmon sperm, of all things) and then a gel is run with the incubated sample and a control (sample that has not been in contact with the TF). If the TF has bound the sample, the complex will migrate more slowly than unbound DNA through the gel, and this retarded band can be used as evidence of binding. The unspecific DNA ensures that the binding is specific to the fragment of interest and that any non-specific DNA-binding proteins left-over in the TF purification will bind there, instead of on the fragment of interest. EMSAs are typically carried out in a bunch of fragments, shown as multiple double (control+experiment) lanes in a wide picture. Certain additional controls are run in at least one of the fragments to ascertain specificity. In the most basic of these, specific competitor (the fragment of interest or a known positive control, unlabelled) is added to the reaction. This should sequester the TF and hence make the retardation band disappear, proving that the binding is indeed specific - Experimental technique details qRT-PCR [RNA] (ECO:0001808) qRT-PCR [RNA] - ECO:0001808 Quantitative Reverse-Transcription PCR is a modification of PCR in which RNA is first reverse transcribed into cDNA and this is amplified measuring the product (qPCR) in real time. It therefore allows one to analyze transcription by directly measuring the product (RNA) of a gene's transcription. If the gene is transcribed more, the starting product for PCR is larger and the corresponding volume of amplification is also larger. - Experimental technique details Visual sequence inspection (nan) Visual sequence inspection - nan Visual inspection of promoter region to identify putative binding sites based on previous knowledge -	repressor	not specified
ATAGCCAAAACCAATCGAAAGCATGAGCTTTGCCAAT	ahpC,	Experimental technique details EMSA (ECO:0001807) EMSA - ECO:0001807 Electro-mobility shift-assays (or gel retardation assays) are a standard way of assessing TF-binding. A fragment of DNA of interest is amplified and labeled with a fluorophore. The fragment is left to incubate in a solution containing abundant TF and non-specific DNA (e.g. randomly cleaved DNA from salmon sperm, of all things) and then a gel is run with the incubated sample and a control (sample that has not been in contact with the TF). If the TF has bound the sample, the complex will migrate more slowly than unbound DNA through the gel, and this retarded band can be used as evidence of binding. The unspecific DNA ensures that the binding is specific to the fragment of interest and that any non-specific DNA-binding proteins left-over in the TF purification will bind there, instead of on the fragment of interest. EMSAs are typically carried out in a bunch of fragments, shown as multiple double (control+experiment) lanes in a wide picture. Certain additional controls are run in at least one of the fragments to ascertain specificity. In the most basic of these, specific competitor (the fragment of interest or a known positive control, unlabelled) is added to the reaction. This should sequester the TF and hence make the retardation band disappear, proving that the binding is indeed specific - Experimental technique details qRT-PCR [RNA] (ECO:0001808) qRT-PCR [RNA] - ECO:0001808 Quantitative Reverse-Transcription PCR is a modification of PCR in which RNA is first reverse transcribed into cDNA and this is amplified measuring the product (qPCR) in real time. It therefore allows one to analyze transcription by directly measuring the product (RNA) of a gene's transcription. If the gene is transcribed more, the starting product for PCR is larger and the corresponding volume of amplification is also larger. - Experimental technique details Visual sequence inspection (nan) Visual sequence inspection - nan Visual inspection of promoter region to identify putative binding sites based on previous knowledge -	repressor	not specified