Curation Information

Publication
The Pseudomonas aeruginosa fumc and soda genes belong to an iron-responsive operon.;Polack B, Dacheux D, Delic-Attree I, Toussaint B, Vignais PM;Biochemical and biophysical research communications 1996 Sep 13; 226(2):555-60 [8806672]
TF
Fur [P0A9A9, view regulon]
Reported TF sp.
Pseudomonas aeruginosa PAO1
Reported site sp.
Pseudomonas aeruginosa PAO1
Created by
Dinara Sagitova
Curation notes
-

Experimental Process

A putative Fur binding site was identified in the upstream region of the fumC-sodA operon. EMSA confirmed that E.coli Fur could bind to the 60 bp long fragment of the fumC-sodA upstream region.

Transcription Factor Binding Sites


CAATAATCAATCTCATTATC
CAATAATCAATCTCATTATC

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
CAATAATCAATCTCATTATC
... ... 5000000 PA4471 fumC1 PA4469 sodM PA4467
Experimental technique details EMSA (ECO:0001807) - Experimental technique details Visual sequence inspection (nan) - not specified not specified