A putative Fur binding site was identified in the upstream region of the fumC-sodA operon. EMSA confirmed that E.coli Fur could bind to the 60 bp long fragment of the fumC-sodA upstream region.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
CAATAATCAATCTCATTATC |
|
not specified | not specified |