Curation Information

Publication
MexZ-mediated regulation of mexXY multidrug efflux pump expression in Pseudomonas aeruginosa by binding on the mexZ-mexX intergenic DNA.;Matsuo Y, Eda S, Gotoh N, Yoshihara E, Nakae T;FEMS microbiology letters 2004 Sep 1; 238(1):23-8 [15336398]
TF
MexZ [G3XCU9, view regulon]
Reported TF sp.
Pseudomonas aeruginosa PAO1
Reported site sp.
Pseudomonas aeruginosa PAO1
Created by
Joe Sparenberg
Curation notes
-

Experimental Process

EMSA was used to test physical interaction of MexZ with the mexXY promoter region and showed direct binding at the mexZ-mexZ intergenic region. EMSA was used on mexXY promoter fragments of different lengths to locate the binding sites and included an inverted repeat of 10-bp separated by 4-bp.

Transcription Factor Binding Sites


TTAATTAATCACTCATGATTGATTATATGCTACTGTCGC
TTAATTAATCACTCATGATTGATTATATGCTACTGTCGC

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type