Curation Information

Publication
Molecular characterization of MexL, the transcriptional repressor of the mexJK multidrug efflux operon in Pseudomonas aeruginosa.;Chuanchuen R, Gaynor JB, Karkhoff-Schweizer R, Schweizer HP;Antimicrobial agents and chemotherapy 2005 May; 49(5):1844-51 [15855505]
TF
MexL [Q9HXW2, view regulon]
Reported TF sp.
Pseudomonas aeruginosa PAO1
Reported site sp.
Pseudomonas aeruginosa PAO1
Created by
Grace Chandler
Curation notes
-

Experimental Process

EMSAs were performed on the 94-bp mexL-mexJ intergenic region, demonstrating that MexL binds specifically. Visual inspection revealed two inverted GTATTT repeats on the mexL-mexJ intergenic region, separated by 16 bp. DNase I footprinting was performed to further map the operator sites, revealing a single protected region on both the mexL and mexJ coding strands, with the regions almost perfectly overlapping. LacZ fusion assays demonstrated auto-repression of mexL with expression levels lower in the presence of MexL.

Transcription Factor Binding Sites


GAAATACTGGACTGATGGGTTCTGTATTTTTACTATACCGCCCAGTATAAGAACTCGAACGC
ATTGAAATACTGGACTGATGGGTTCTGTATTTTTACTATACCGCCCAGTATAAGAACTCGAA
GAAATACTGGACTGATGGGTTCTGTATTTTTACTATACCGCCCAGTATAAGAACTCGAACGC
ATTGAAATACTGGACTGATGGGTTCTGTATTTTTACTATACCGCCCAGTATAAGAACTCGAA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type