Multiple sequence alignment identified identified a putative ArgR box within the argB promoter. EMSA with different length probes of the argB promoter identified the sequence region important for ArgR binding. RT-PCR confirmed that argB expression is regulated by ArgR. Site-directed mutagenesis in conjunction with EMSA further verified the functionality of the putative ArgR binding site.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
TCCGCGTACAGCTCTTAAAAAGAAACA | argB, |
|
activator | not specified |