Curation Information

Publication
PchR-box recognition by the AraC-type regulator PchR of Pseudomonas aeruginosa requires the siderophore pyochelin as an effector.;Michel L, González N, Jagdeep S, Nguyen-Ngoc T, Reimmann C;Molecular microbiology 2005 Oct; 58(2):495-509 [16194235]
TF
PchR [P40883, view regulon]
Reported TF sp.
Pseudomonas aeruginosa PAO1
Reported site sp.
Pseudomonas aeruginosa PAO1
Created by
Grace Chandler
Curation notes
-

Experimental Process

Alignment of pchDCBA, pchEFGHI, and fptA promoter regions identified a PchR consensus . pchD-lacZ fusion with progressive deletions in the promoter of the wild-type P. aeruginosa and pyochelin mutant strains demonstrated that this putative binding site is important for pchD expression activation by PchR. Site-directed mutagenesis combined with pchD-lacZ fusion verified PchR as a direct activator of pchD expression. pchR-lacZ fusion assay demonstrated that the pchR expression levels were lower after site-directed mutagenesis, demonstrating the role of PchR as an autorepressor. EMSA with the pchR-pchD intergenic region confirmed binding of PchR to the PchR-box.

Transcription Factor Binding Sites


CTGCAGCGAATGAAAAAGCCCCGCAATCGAAA
CTGCAGCGAATGAAAAAGCCCCGCAATCGAAA
CTGCAGCGAATGAAAAAGCCCCGCAATCGAAA
CTGCAGCGAATGAAAAAGCCCCGCAATCGAAA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
CTGCAGCGAATGAAAAAGCCCCGCAATCGAAA pchD,
... ... pchD pchA pchB pchC pchR
Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details Site directed mutagenesis (ECO:0005667) - activator not specified
CTGCAGCGAATGAAAAAGCCCCGCAATCGAAA pchR,
... ... pchR pchD pchC pchB pchA
Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details Site directed mutagenesis (ECO:0005667) - repressor not specified