EMSA demonstrated QscR binding to the promoter region of PA1897. DNase I footprinting revealed a 20-bp inverted repeat sequence protected by QscR in the presence of 3OC12. Beta-gal assays performed with and without 30C12 confirmed that QscR directly activates the expression of PA1897. Functionality of the QscR binding site was validated by site-directed mutagenesis in conjunction with EMSAs.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
ACCTGCCCGGAAGGGCAGGTTGTCCC | PA1897, |
|
activator | dimer |