Curation Information

Publication
The arginine regulatory protein mediates repression by arginine of the operons encoding glutamate synthase and anabolic glutamate dehydrogenase in Pseudomonas aeruginosa.;Hashim S, Kwon DH, Abdelal A, Lu CD;Journal of bacteriology 2004 Jun; 186(12):3848-54 [15175298]
TF
ArgR [G3XCU2, view regulon]
Reported TF sp.
Pseudomonas aeruginosa PAO1
Reported site sp.
Pseudomonas aeruginosa PAO1
Created by
Grace Chandler
Curation notes
-

Experimental Process

Transcription start sites for gltBD and gdhA promoters were identified by primer extension analysis. gltB::lacZ and gdhA:: lacZ fusion assays showed repression by ArgR in the presence of arginine in the wild type but not in the argR knockout mutant. EMSA demonstrated that ArgR specifically binds to the gltBD regulatory region. Similarly, EMSAs showed that ArgR binds to gdhA promoter. DNAse I footprinting identified the location of the binding sites in the gdhA and gltBD promoter regions. Multiple sequence alignment determined an ArgR consensus binding motif.

Transcription Factor Binding Sites


TCGTCTTTCATTTTGGCGACATTGAATTTCATTTTCTCGCCG
GAAAGTTTCAGTTTTGCACCATAAAGATTCATCAATGCGTCA
TCGTCTTTCATTTTGGCGACATTGAATTTCATTTTCTCGCCG
GAAAGTTTCAGTTTTGCACCATAAAGATTCATCAATGCGTCA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
TCGTCTTTCATTTTGGCGACATTGAATTTCATTTTCTCGCCG gltB, gltD
... ... gltB gltD
Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - repressor not specified
GAAAGTTTCAGTTTTGCACCATAAAGATTCATCAATGCGTCA gdhA
... ... gdhA
Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - repressor not specified