Curation Information

Publication
Transcriptional control of the Bradyrhizobium japonicum irr gene requires repression by fur and Antirepression by Irr.;Hohle TH, O'Brian MR;The Journal of biological chemistry 2010 Aug 20; 285(34):26074-80 [20573962]
TF
Irr [H7C6K3, view regulon]
Reported TF sp.
Bradyrhizobium diazoefficiens USDA 110
Reported site sp.
Bradyrhizobium diazoefficiens USDA 110
Created by
Grace Chandler
Curation notes
Irr acts as an antirepressor of the irr expression.

Experimental Process

qRT-PCR was used to determine that the irr gene expression is regulated by both iron and manganese. DNAse I footprinting identified the Irr binding site within the -64 to -39 region of the Irr promoter.

Transcription Factor Binding Sites


CGATTAGAACCTCTCTAGTTGCGAGA
CGATTAGAACCTCTCTAGTTGCGAGA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type