Curation Information

Publication
Fur-independent regulation of iron metabolism by Irr in Bradyrhizobium japonicum.;Hamza I, Qi Z, King ND, O'Brian MR;Microbiology (Reading, England) 2000 Mar; 146 ( Pt 3)():669-76 [10746770]
TF
Fur [H7C6Q1, view regulon]
Reported TF sp.
Bradyrhizobium diazoefficiens USDA 110
Reported site sp.
Bradyrhizobium diazoefficiens USDA 110
Created by
Grace Chandler
Curation notes
-

Experimental Process

Beta-gal fusion assays demonstrated that Fur directly regulates the irr gene as a threefold repression of irr occurred when the fur gene was introduced. EMSA confirmed Fur binding to the irr promoter.

Transcription Factor Binding Sites


CCTCGCTCGGTTCCACTCCGATTAGAACCTCTCTAGTTGCGAGAAACTTGCATCTGCATCTAT
CCTCGCTCGGTTCCACTCCGATTAGAACCTCTCTAGTTGCGAGAAACTTGCATCTGCATCTAT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type