Curation Information

Publication
The iron-responsive regulator fur is transcriptionally autoregulated and not essential in Neisseria meningitidis.;Delany I, Ieva R, Alaimo C, Rappuoli R, Scarlato V;Journal of bacteriology 2003 Oct; 185(20):6032-41 [14526014]
TF
Fur [P0A0S8, view regulon]
Reported TF sp.
Neisseria meningitidis MC58
Reported site sp.
Neisseria meningitidis MC58
Created by
Grace Chandler
Curation notes
-

Experimental Process

Primer extension and S1 nuclease experiments identified fur is transcribed from two independent promoters. DNase I footprinting analysis showed that Fur binds to two regions in the fur upstream region with different affinities. Visual inspection of the protected region identified two Fur box-like sequences with seven and eight mismatches from the E.coli Fur box consensus.

Transcription Factor Binding Sites


ATATTTTATAAAAGCGAACGATAATCATACGATTAAGC
CGTATTATAACGTCTATTGTTTTACA
ATATTTTATAAAAGCGAACGATAATCATACGATTAAGC
CGTATTATAACGTCTATTGTTTTACA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
ATATTTTATAAAAGCGAACGATAATCATACGATTAAGC fur,
... ... fur NMB0204 dapB aat
Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details Primer Extension assay (ECO:0005657) - Experimental technique details S1 nuclease protection (ECO:0005666) - Experimental technique details Visual sequence inspection (nan) - repressor not specified
CGTATTATAACGTCTATTGTTTTACA fur,
... ... fur NMB0204 dapB aat
Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details Primer Extension assay (ECO:0005657) - Experimental technique details S1 nuclease protection (ECO:0005666) - Experimental technique details Visual sequence inspection (nan) - not specified dimer