qRT-PCR was used to determine that the irr expression is regulated by both iron and manganese. DNAse I footprinting identified the Irr and Fur binding sites within the Irr promoter.In vitro transcription analysis showed that Fur represses the Irr promoter and this repression is relieved by Irr.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
GTTGCGAGAAACTTGCATCTGCATCTA | irr, |
|
repressor | not specified |