Curation Information

Publication
Transcriptional control of the Bradyrhizobium japonicum irr gene requires repression by fur and Antirepression by Irr.;Hohle TH, O'Brian MR;The Journal of biological chemistry 2010 Aug 20; 285(34):26074-80 [20573962]
TF
Fur [H7C6Q1, view regulon]
Reported TF sp.
Bradyrhizobium diazoefficiens USDA 110
Reported site sp.
Bradyrhizobium diazoefficiens USDA 110
Created by
Grace Chandler
Curation notes
-

Experimental Process

qRT-PCR was used to determine that the irr expression is regulated by both iron and manganese. DNAse I footprinting identified the Irr and Fur binding sites within the Irr promoter.In vitro transcription analysis showed that Fur represses the Irr promoter and this repression is relieved by Irr.

Transcription Factor Binding Sites


GTTGCGAGAAACTTGCATCTGCATCTA
GTTGCGAGAAACTTGCATCTGCATCTA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
GTTGCGAGAAACTTGCATCTGCATCTA irr,
... ... irr fabA fabB fabI blr0772
Experimental technique details ChIP-PCR (ECO:0005620) - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details In-vitro transcription (ECO:0001204) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - repressor not specified