Curation Information

Publication
Activation and repression of a sigmaN-dependent promoter naturally lacking upstream activation sequences.;Porrúa O, García-González V, Santero E, Shingler V, Govantes F;Molecular microbiology 2009 Aug; 73(3):419-33 [19570137]
TF
AtzR [Q936X4, view regulon]
Reported TF sp.
Pseudomonas sp. ADP
Reported site sp.
Pseudomonas sp. ADP
Created by
Dinara Sagitova
Curation notes
-

Experimental Process

Repression of the PatzR promoter by AtzR was shown through in-vitro transcription in the presence of increased concentrations of His-tagged AtzR. Higher AtzR concentration was required when the ABS secondary site was deleted. EMSAs showed that AtzR binds the PatzR promoter and that it competes with sigma-N for binding. This was further confirmed by DNAse footprinting.

The paper reports that TF forms complex with other proteins for binding with reported sites.

AtzR and Sigma-N compete for binding, leading to PatzR repression.

Transcription Factor Binding Sites


TGGTGCCGATCCGGCACC
CGCACTTGACTGCCGCCTTTTTCCGACC
TGGTGCCGATCCGGCACC
CGCACTTGACTGCCGCCTTTTTCCGACC

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
TGGTGCCGATCCGGCACC orf99,
... ... orf99 orf98 orf97 orf96 orf95 orf94 atzD
Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details In-vitro transcription (ECO:0001204) - repressor tetramer
CGCACTTGACTGCCGCCTTTTTCCGACC
... ... orf99 orf98 orf97 orf96 orf95 orf94 atzD
Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details In-vitro transcription (ECO:0001204) - not specified tetramer