Curation Information

Publication
Transcription and autoregulation of the Rv3134c-devR-devS operon of Mycobacterium tuberculosis.;Bagchi G, Chauhan S, Sharma D, Tyagi JS;Microbiology (Reading, England) 2005 Dec; 151(Pt 12):4045-53 [16339949]
TF
DosR [I6XGD8, view regulon]
Reported TF sp.
Mycobacterium tuberculosis H37Rv
Reported site sp.
Mycobacterium tuberculosis H37Rv
Created by
Talmo Pereira
Curation notes
The paper clearly shows binding data, but only using large intergenic regions, without sequencing or otherwise narrowing down what sites are actually being bound. The putative binding sites found were from a computational consensus search and it was presumed that since those sites were also in that promoter region, evidence of binding through EMSA suggests binding to those sites.

Experimental Process

Transcription start points determined by primer extension. In silico search for consensus sequence in promoter region using MyPatternFinder (http://www.nii.ac.in/~deepak/MyPattern/) found 6 high scoring sites not previously reported in literature. Expression measured with GFP fusion. Western blot to confirm expression. EMSA to demonstrate binding of DevR using entire promoter region. binding sites NOT sequenced -- putative binding sites from computational analysis assumed to bind.

Transcription Factor Binding Sites


ACCTGGACGAGCCACCCGTG
ACGGGATGTATCCGCCCCAG
GGTCGGCCTTATGCCCCGTG
TGCGGGTGGATCGGGCCATC
ACCTGGACGAGCCACCCGTG
ACGGGATGTATCCGCCCCAG
GGTCGGCCTTATGCCCCGTG
TGCGGGTGGATCGGGCCATC

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
ACCTGGACGAGCCACCCGTG RVBD_3134c,
... ... RVBD_3134c RVBD_3133c RVBD_3132c RVBD_3135 RVBD_3131
Experimental technique details Consensus search (ECO:0005624) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details GFP Promoter Fusion (ECO:0005636) - Experimental technique details Primer Extension assay (ECO:0005657) - activator dimer
ACGGGATGTATCCGCCCCAG RVBD_3134c,
... ... RVBD_3134c RVBD_3135 RVBD_3131 RVBD_3132c RVBD_3133c
Experimental technique details Consensus search (ECO:0005624) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details GFP Promoter Fusion (ECO:0005636) - Experimental technique details Primer Extension assay (ECO:0005657) - activator dimer
GGTCGGCCTTATGCCCCGTG RVBD_3134c,
... ... RVBD_3134c RVBD_3133c RVBD_3135 RVBD_3131 RVBD_3132c
Experimental technique details Consensus search (ECO:0005624) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details GFP Promoter Fusion (ECO:0005636) - Experimental technique details Primer Extension assay (ECO:0005657) - activator dimer
TGCGGGTGGATCGGGCCATC RVBD_3134c,
... ... RVBD_3134c RVBD_3131 RVBD_3132c RVBD_3133c RVBD_3135
Experimental technique details Consensus search (ECO:0005624) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details GFP Promoter Fusion (ECO:0005636) - Experimental technique details Primer Extension assay (ECO:0005657) - activator dimer