LacZ fusion assays with cbpA promoter fragments of different lengths verified Vfr-dependent regulation of cbpA and localized the binding region in the cbpA promoter. Visual sequence inspection identified a putative Vfr binding site resembling the Vfr consensus sequence. EMSA confirmed binding of Vfr to its target binding site.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
GAAACAAGAGCTAGCTCACAC | cbpA, |
|
activator | not specified |