Curation Information

Publication
CbpA: a polarly localized novel cyclic AMP-binding protein in Pseudomonas aeruginosa.;Endoh T, Engel JN;Journal of bacteriology 2009 Dec; 191(23):7193-205 [19801409]
TF
Vfr [P55222, view regulon]
Reported TF sp.
Pseudomonas aeruginosa PAO1
Reported site sp.
Pseudomonas aeruginosa PAO1
Created by
Grace Chandler
Curation notes
-

Experimental Process

LacZ fusion assays with cbpA promoter fragments of different lengths verified Vfr-dependent regulation of cbpA and localized the binding region in the cbpA promoter. Visual sequence inspection identified a putative Vfr binding site resembling the Vfr consensus sequence. EMSA confirmed binding of Vfr to its target binding site.

Transcription Factor Binding Sites


GAAACAAGAGCTAGCTCACAC
GAAACAAGAGCTAGCTCACAC

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
GAAACAAGAGCTAGCTCACAC cbpA,
... ... cbpA PA4703 prrF1 prrF2
Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details Visual sequence inspection (nan) - activator not specified