Curation Information

Publication
Prevalence of SOS-mediated control of integron integrase expression as an adaptive trait of chromosomal and mobile integrons.;Cambray G, Sanchez-Alberola N, Campoy S, Guerin E, Da Re S, González-Zorn B, Ploy MC, Barbé J, Mazel D, Erill I;Mobile DNA 2011 Apr 30; 2(1):6 [21529368]
TF
LexA [Q87KN2, view regulon]
Reported TF sp.
Vibrio parahaemolyticus RIMD 2210633
Reported site sp.
Vibrio parahaemolyticus RIMD 2210633
Created by
Erill Lab
Curation notes
-

Experimental Process

Sites were identified with a PSSM search with the known LexA E. coli motif in the promoters of integron integrases from several classes and their position relative to transcriptional and translational start sites validated through multiple sequence alignment. Binding of LexA to the V. parahaemolyticus intIA site was validate through EMSA and its effect on the expression of the integrase gene was assessed through RT-PCR, comparing lexA mutant to wild-type.

Transcription Factor Binding Sites


ACCTGTATAAATAAACAGAC
ACCTGTATAAATAAACAGAC

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
ACCTGTATAAATAAACAGAC VP1865
... ... VP1865
Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details PSSM site search (ECO:0005659) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - repressor dimer