Curation Information

Publication
Cooperative binding of phosphorylated DevR to upstream sites is necessary and sufficient for activation of the Rv3134c-devRS operon in Mycobacterium tuberculosis: implication in the induction of DevR target genes.;Chauhan S, Tyagi JS;Journal of bacteriology 2008 Jun; 190(12):4301-12 [18359816]
TF
DosR [I6XGD8, view regulon]
Reported TF sp.
Mycobacterium tuberculosis H37Rv
Reported site sp.
Mycobacterium tuberculosis H37Rv
Created by
Talmo Pereira
Curation notes
-

Experimental Process

Rv3135 which shares intergenic region with Rv3134c found via site-directed mutagenesis and GFP reporter assay to not be regulated by DevR under low oxygen (hypoxic) conditions. Rv3134c is found to be regulated by DevR via the same assays. Rv3134c start site mapped by primer extension. EMSA and DNAse I footprinting done with upstream region of Rv3134c identified two binding regions. Site-directed mutagenesis with GFP reporter assay confirmed expression of Rv3134c is reduced by mutations in binding sites.

Transcription Factor Binding Sites


GTGGGGACCAACGCCCCTGG
ATAAGGACTAACGGCCCTCA
GTGGGGACCAACGCCCCTGG
ATAAGGACTAACGGCCCTCA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
GTGGGGACCAACGCCCCTGG RVBD_3134c,
... ... RVBD_3134c RVBD_3133c RVBD_3135 RVBD_3131 RVBD_3132c
Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details GFP Promoter Fusion (ECO:0005636) - Experimental technique details Primer Extension assay (ECO:0005657) - Experimental technique details Site directed mutagenesis (ECO:0005667) - activator dimer
ATAAGGACTAACGGCCCTCA RVBD_3134c,
... ... RVBD_3134c RVBD_3135 RVBD_3131 RVBD_3132c RVBD_3133c
Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details GFP Promoter Fusion (ECO:0005636) - Experimental technique details Primer Extension assay (ECO:0005657) - Experimental technique details Site directed mutagenesis (ECO:0005667) - activator dimer