Rv3135 which shares intergenic region with Rv3134c found via site-directed mutagenesis and GFP reporter assay to not be regulated by DevR under low oxygen (hypoxic) conditions. Rv3134c is found to be regulated by DevR via the same assays. Rv3134c start site mapped by primer extension. EMSA and DNAse I footprinting done with upstream region of Rv3134c identified two binding regions. Site-directed mutagenesis with GFP reporter assay confirmed expression of Rv3134c is reduced by mutations in binding sites.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
GTGGGGACCAACGCCCCTGG | RVBD_3134c, |
|
activator | dimer | |
ATAAGGACTAACGGCCCTCA | RVBD_3134c, |
|
activator | dimer |