Curation Information

Publication
Promoter recognition and activation by the global response regulator CbrB in Pseudomonas aeruginosa.;Abdou L, Chou HT, Haas D, Lu CD;Journal of bacteriology 2011 Jun; 193(11):2784-92 [21478360]
TF
CbrB [Q9HV73, view regulon]
Reported TF sp.
Pseudomonas aeruginosa PAO1
Reported site sp.
Pseudomonas aeruginosa PAO1
Created by
Dinara Sagitova
Curation notes
-

Experimental Process

Site-directed mutagenesis of the crcZ promoter region with lacZ fusion assays in wild-type and rpoN and a cbrB mutant confirmed specific CbrB interaction with the crcZ promoter. Promoter deletion analysis with EMSA confirmed binding of CbrB to its recognition site.

Transcription Factor Binding Sites


CTGTTACCGCGGACGTACCGCGTAACAG
GCGTTTCGCGCCGTAACAA
CTGTTACCGCGGACGTACCGCGTAACAG
GCGTTTCGCGCCGTAACAA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
CTGTTACCGCGGACGTACCGCGTAACAG crcZ,
... ... crcZ PA4726.1
Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details Visual sequence inspection (nan) - activator not specified
GCGTTTCGCGCCGTAACAA lipA,
... ... lipA ligT PA2860
Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details Visual sequence inspection (nan) - activator not specified