Site-directed mutagenesis of the crcZ promoter region with lacZ fusion assays in wild-type and rpoN and a cbrB mutant confirmed specific CbrB interaction with the crcZ promoter. Promoter deletion analysis with EMSA confirmed binding of CbrB to its recognition site.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
CTGTTACCGCGGACGTACCGCGTAACAG | crcZ, |
|
activator | not specified | |
GCGTTTCGCGCCGTAACAA | lipA, |
|
activator | not specified |