Curation Information

Publication
The LysR-type regulator AtzR binding site: DNA sequences involved in activation, repression and cyanuric acid-dependent repositioning.;PorrĂșa O, GarcĂ­a-Jaramillo M, Santero E, Govantes F;Molecular microbiology 2007 Oct; 66(2):410-27 [17854404]
TF
AtzR [Q936X4, view regulon]
Reported TF sp.
Pseudomonas sp. ADP
Reported site sp.
Pseudomonas sp. ADP
Created by
Dinara Sagitova
Curation notes
-

Experimental Process

Deletional analyses of the atzR and the atzDEF promoters with lacZ promoter fusions were used to identify AtzR binding sites. EMSA verified AtzR binding to both promoters. DNase I footprinting was done to localize the sequences protected by AtzR. The authors identify a repressor site consisting of two hexamers (RBS) and a secondary site consisting of three additional hexamers (ABS), but show that only RBS is strictly necessary for binding.

Transcription Factor Binding Sites


GGTCGGAAAAAGGCGGCAGTCAAGTGCG
GGTGCCGGATCGGCACCA
GGTCGGAAAAAGGCGGCAGTCAAGTGCG
GGTGCCGGATCGGCACCA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
GGTGCCGGATCGGCACCA orf99,
... ... orf99 orf98 orf97 orf96 orf95 orf94 atzD
Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Visual sequence inspection (nan) - repressor tetramer
GGTCGGAAAAAGGCGGCAGTCAAGTGCG atzD,
... ... atzD orf99 orf98 orf97 orf96 orf95 orf94
Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Visual sequence inspection (nan) - activator tetramer