Curation Information

Publication
Rv3133c/dosR is a transcription factor that mediates the hypoxic response of Mycobacterium tuberculosis.;Park HD, Guinn KM, Harrell MI, Liao R, Voskuil MI, Tompa M, Schoolnik GK, Sherman DR;Molecular microbiology 2003 May; 48(3):833-43 [12694625]
TF
DosR [I6XGD8, view regulon]
Reported TF sp.
Mycobacterium tuberculosis H37Rv
Reported site sp.
Mycobacterium tuberculosis H37Rv
Created by
Talmo Pereira
Curation notes
-

Experimental Process

Microarray analysis defines the DosR regulon and indicates that it may play a role in hypoxic response. Binding motifs upstream of acr gene is calculated using motif-discovery program YMF (http://frizzled.cs.washington.edu/YMF/YMFWeb/intro.pl#YMF) and palindromic consensus sequence is discovered. Primer extension used to discover transcription start site of gene. EMSA confirms that TF binds to upstream region of gene.

Transcription Factor Binding Sites


TCGGGGACTTCTGTCCCTAG
ACAGGGTCAATGGTCCCCAA
TCGGGGACTTCTGTCCCTAG
ACAGGGTCAATGGTCCCCAA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
TCGGGGACTTCTGTCCCTAG RVBD_2031c,
... ... RVBD_2031c RVBD_2032 RVBD_2028c RVBD_2029c RVBD_2030c
Experimental technique details EMSA (ECO:0001807) - Experimental technique details Luciferase reporter assay (ECO:0005648) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details Primer Extension assay (ECO:0005657) - Experimental technique details Site directed mutagenesis (ECO:0005667) - activator dimer
ACAGGGTCAATGGTCCCCAA RVBD_2031c,
... ... RVBD_2031c RVBD_2030c RVBD_2032 RVBD_2028c RVBD_2029c
Experimental technique details EMSA (ECO:0001807) - Experimental technique details Luciferase reporter assay (ECO:0005648) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details Primer Extension assay (ECO:0005657) - Experimental technique details Site directed mutagenesis (ECO:0005667) - activator dimer