Curation Information

Publication
Transcriptional regulation of the CmeABC multidrug efflux pump and the KatA catalase by CosR in Campylobacter jejuni.;Hwang S, Zhang Q, Ryu S, Jeon B;Journal of bacteriology 2012 Dec; 194(24):6883-91 [23065977]
TF
CosR [Q0PBF4, view regulon]
Reported TF sp.
Campylobacter jejuni subsp. jejuni NCTC 11168 = ATCC 700819
Reported site sp.
Campylobacter jejuni subsp. jejuni NCTC 11168 = ATCC 700819
Created by
Grace Chandler
Curation notes
-

Experimental Process

DNA microarrays identified genes differentially expressed in the CosR-mutant strain. CosR-dependent regulation of some of these genes was further verified by qRT-PCR. cmeABC-lacZ fusion assay showed that CosR represses cmeABC expression. By measuring the catalase activity, katA expression was shown to be activated by CosR. EMSA confirmed that katA promoter was bound by CosR. DNase I footprinting localized the CosR binding sites in the katA and cmeABC promoters. Alignment with the known CosR binding sites identified a new consensus (ttTaAanaAAAaTTAagaTTT).

Transcription Factor Binding Sites


TATTAACCAAAATTAAGATAT
ATTCAGTTAATTTTAATTTTT
TATTAACCAAAATTAAGATAT
ATTCAGTTAATTTTAATTTTT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
TATTAACCAAAATTAAGATAT cmeA, cmeB, cmeC
... ... cmeA cmeB cmeC
Experimental technique details Beta-gal reporter assay - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - repressor not specified
ATTCAGTTAATTTTAATTTTT katA,
... ... katA Cj1384c Cj1383c fldA Cj1386
Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - activator not specified