Curation Information

Publication
Synergistic activation of the pathogenicity-related proline iminopeptidase gene in Xanthomonas campestris pv. campestris by HrpX and a LuxR homolog.;Zhang J, Kan J, Zhang J, Guo P, Chen X, Fang R, Jia Y;Applied and environmental microbiology 2012 Oct; 78(19):7069-74 [22865058]
TF
HrpX [Q8PBF5, view regulon]
Reported TF sp.
Xanthomonas campestris pv. campestris str. 8004
Reported site sp.
Xanthomonas campestris pv. campestris str. 8004
Created by
Dinara Sagitova
Curation notes
-

Experimental Process

HrpX-dependent regulation was verified by GUS reporter gene assay. HrpX binding to the imperfect PIP box was confirmed by ChIP-PCR and EMSA.

Transcription Factor Binding Sites


TTCGCGCGTTTCGCAATTGCC
TTCGCGCGTTTCGCAATTGCC

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
TTCGCGCGTTTCGCAATTGCC XC_1296
... ... XC_1296
Experimental technique details ChIP-PCR (ECO:0005620) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details GUS reporter gene assay (ECO:0005641) - activator not specified