HrpX-dependent regulation was verified by GUS reporter gene assay. HrpX binding to the imperfect PIP box was confirmed by ChIP-PCR and EMSA.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
TTCGCGCGTTTCGCAATTGCC | XC_1296 |
|
activator | not specified |