Curation Information

Publication
Effects on promoter activity of base substitutions in the cis-acting regulatory element of HrpXo regulons in Xanthomonas oryzae pv. oryzae.;Tsuge S, Terashima S, Furutani A, Ochiai H, Oku T, Tsuno K, Kaku H, Kubo Y;Journal of bacteriology 2005 Apr; 187(7):2308-14 [15774873]
TF
HrpX [Q9ZIP8, view regulon]
Reported TF sp.
Xanthomonas oryzae pv. oryzae MAFF 311018
Reported site sp.
Xanthomonas oryzae pv. oryzae MAFF 311018
Created by
Dinara Sagitova
Curation notes
-

Experimental Process

Regulation was shown by RT-PCR and GUS reporter assays. Specific regulation of xoo0804 abd xoo0803 expression by HrpX was confirmed by site-directed mutagenesis.

Transcription Factor Binding Sites


TTCGCTTAACGCGACCGGTCTGCGG
TTCGCCAAATCGCACATCGATTCTG
TTCGCTTAACGCGACCGGTCTGCGG
TTCGCCAAATCGCACATCGATTCTG

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
TTCGCTTAACGCGACCGGTCTGCGG XOO_0804
... ... XOO_0804
Experimental technique details GUS reporter gene assay (ECO:0005641) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - Experimental technique details Site directed mutagenesis (ECO:0005667) - activator dimer
TTCGCCAAATCGCACATCGATTCTG XOO_3803,
... ... XOO_3803 XOO_3802
Experimental technique details GUS reporter gene assay (ECO:0005641) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - Experimental technique details Site directed mutagenesis (ECO:0005667) - activator dimer