RT-PCR analysis using RNA isolated from clp mutant strain showed that transcription of the xpsE gene was reduced. GUS activity assay revealed that xpsE promoter activity in the clp mutant was reduced compared to that in WT strain. The putative Clp binding site was identified by searching the upstream region of xpsE with the CRP-consensus sequence. EMSA showed that Clp bound to the 500-bp DNA fragment containing the putative binding sequence from the xpsE promoter.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
AACGGTGCGCTTCACCGCACCC | XC_3573, |
|
activator | not specified |