Curation Information

Publication
NikR is a ribbon-helix-helix DNA-binding protein.;Chivers PT, Sauer RT;Protein science : a publication of the Protein Society 1999 Nov; 8(11):2494-500 [10595554]
TF
NikR [P0A6Z6, view regulon]
Reported TF sp.
Escherichia coli strain MC1061
Reported site sp.
Escherichia coli strain MC1061
Created by
Erill Lab
Curation notes
-

Experimental Process

The binding site for NikR is identified by performing DNAse footprinting experiments with purified NikR N-term, both for wild-type and for a beta-sheet mutant unable to bind.

Transcription Factor Binding Sites


AATCAGTATGACGAATACTTAAAATCGTCATATA
AATCAGTATGACGAATACTTAAAATCGTCATACT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type