EMSAs and dimethyl sulfate protection experiments with purified Arc and arc operator are used in conjunction with extensive site-directed mutagenesis of the arc operator in order to demonstrate that the TAGA/TCTA dyad is the most essential component of the dyad-spacer motif.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
ATGATAGAAGCACTCTACTAT |
|
repressor | tetramer |