Curation Information

Publication
Arc repressor is tetrameric when bound to operator DNA.;Brown BM, Bowie JU, Sauer RT;Biochemistry 1990 Dec 25; 29(51):11189-95 [2271706]
TF
Arc [A8CG91, view regulon]
Reported TF sp.
Enterobacteria phage P22
Reported site sp.
Enterobacteria phage P22
Created by
Erill Lab
Curation notes
-

Experimental Process

Purified Arc was used to perform EMSAs on a synthesized arc operator sequence. Wild-type and insertion-bearing (yet functional) Arc proteins were used and the difference in retardation fragments was used to determine the tetrameric nature of Arc binding (as a dimer of dimers).

Transcription Factor Binding Sites


ATGATAGAAGCACTCTACTAT
ATGATAGAAGCACTCTACTAT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
ATGATAGAAGCACTCTACTAT
... ... mnt orf59a ant arc
Experimental technique details EMSA (ECO:0001807) - repressor tetramer