Curation Information

Publication: DNA recognition by beta-sheets in the Arc repressor-operator crystal structure.;Raumann BE, Rould MA, Pabo CO, Sauer RT;Nature 1994 Feb 24; 367(6465):754-7 [8107872]
TF: Arc [A8CG91, view regulon]
Reported TF sp.: Enterobacteria phage P22
Reported site sp.: Enterobacteria phage P22
Created by: Erill Lab
Curation notes: -
External databases: Protein Data Bank (1PAR) .

Experimental Process

Arc tetramer was co-crystallized in complex with the arc operator sequence and examined at 2.6 Å resolution

Transcription Factor Binding Sites

Sites reported in the paper
Sites matched in the genome

ATAGTAGAGTGCTTCTATCAT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence	Regulated genes	Gene diagram	Experimental techniques	TF function	TF type
ATAGTAGAGTGCTTCTATCAT			Experimental technique details X-ray crystallography (ECO:0005670) X-ray crystallography - ECO:0005670 X-ray crystallography is a method to determine the molecular structure of a crystal that is typically used to probe at the tridimensional structure of proteins. In some cases, it is possible to co-crystallize the protein bound to its DNA binding site, providing detail on the particular arrangement of the two components. Doing so provides, obviously, unequivocal evidence of binding. -	repressor	tetramer