HpaR1 binding site was identified by scanning promoter region of the hpaR1. Direct autoregulation of hpaR1 was confirmed by performing EMSA. In vitro transcription assay showed that HpaR1 can repress its own tran- scription level in vitro. hpaR1-GUS reporter assays showed that at HpaR1 can enhance its own expression in vivo when the bacterial cells are inside the host plant.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
GTTGAATACAAAACCAGTCATCCAAC | XC_2736, |
|
not specified | not specified |