OxyR protein was first purified using metal affinity chromatography. A probe containing the kat promoter was incubated with the OxyR protein at varying levels of concentration and digested with DNase 1. Results show a region of protection between -28 and -67 with respect to the +1 transcriptional start site both in the oxidized form and the reduced form of the transcription factor.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
ATTGCTTATAATAATATTAAATCGATTTCATAGTTTTAAT | kat, |
|
repressor | tetramer |