Curation Information

Publication
OxyR tightly regulates catalase expression in Neisseria meningitidis through both repression and activation mechanisms.;Ieva R, Roncarati D, Metruccio MM, Seib KL, Scarlato V, Delany I;Molecular microbiology 2008 Dec; 70(5):1152-65 [18990187]
TF
OxyR [Q9K1H8, view regulon]
Reported TF sp.
Neisseria meningitidis MC58
Reported site sp.
Neisseria meningitidis MC58
Created by
Rajan Patel
Curation notes
-

Experimental Process

OxyR protein was first purified using metal affinity chromatography. A probe containing the kat promoter was incubated with the OxyR protein at varying levels of concentration and digested with DNase 1. Results show a region of protection between -28 and -67 with respect to the +1 transcriptional start site both in the oxidized form and the reduced form of the transcription factor.

Transcription Factor Binding Sites


ATTGCTTATAATAATATTAAATCGATTTCATAGTTTTAAT
ATTGCTTATAATAATATTAAATCGATTTCATAGTTTTAAT

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
ATTGCTTATAATAATATTAAATCGATTTCATAGTTTTAAT kat,
... ... kat NMB0217
Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details Primer Extension assay (ECO:0005657) - repressor tetramer