Curation Information

Publication
Clp upregulates transcription of engA gene encoding a virulence factor in Xanthomonas campestris by direct binding to the upstream tandem Clp sites.;Hsiao YM, Liao HY, Lee MC, Yang TC, Tseng YH;FEBS letters 2005 Jul 4; 579(17):3525-33 [15955530]
TF
Clp [Q4UZF6, view regulon]
Reported TF sp.
Xanthomonas campestris pv. campestris str.17
Reported site sp.
Xanthomonas campestris pv. campestris str.17
Created by
Dinara Sagitova
Curation notes
-

Experimental Process

engA-lacZ promoter fusion assays showed that Clp is required for transcription of the engA gene. Binding was confirmed by EMSAs. Site-directed mutagenesis with EMSA confirmed the binding specificity of Clp to its target promoter. The effect of mutations in the Clp-binding sites was tested by performing a site-directed mutagenesis in conjunction with engA-lacZ fusion assays.

Transcription Factor Binding Sites


CGATGTGATCGGTGCGGCAATG
TTCTGTGGGGACGATCACACCA
CGATGTGATCGGTGCGGCAATG
TTCTGTGGGGACGATCACACCA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
CGATGTGATCGGTGCGGCAATG engXCA,
... ... engXCA ybaR
Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details Visual sequence inspection (nan) - activator not specified
TTCTGTGGGGACGATCACACCA engXCA,
... ... engXCA ybaR
Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details Visual sequence inspection (nan) - activator not specified