Curation Information

Publication
Positive regulation of the Vibrio cholerae porin OmpT by iron and fur.;Craig SA, Carpenter CD, Mey AR, Wyckoff EE, Payne SM;Journal of bacteriology 2011 Dec; 193(23):6505-11 [21965571]
TF
Fur [A5F6G4, view regulon]
Reported TF sp.
Vibrio cholerae O395
Reported site sp.
Vibrio cholerae O395
Created by
Erill Lab
Curation notes
-

Experimental Process

RNA dot blot assay confirmed Fur-dependent activation of the ompT expression. EMSA showed binding of Fur to the ompT promoter region. Site-directed mutagenesis showed the binding is specific.

Transcription Factor Binding Sites


TGAAATAAATGTAATTTATTGAATTTTA
TGAAATAAATGTAATTTATTGAATTTTA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type