DNase I footprinting was used to determine the sequence to which Vfr binds in the promoters it regulates. Sequences protected by Vfr were aligned to identify a preliminary consensus Vfr-binding site.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
AAATGTGATCTAGATCACATTT |
|
not specified | dimer | ||
CTCTGCAATCCAGTTCATAAAT |
|
not specified | dimer |