Curation Information

Publication
Characterization of ExsA and of ExsA-dependent promoters required for expression of the Pseudomonas aeruginosa type III secretion system.;Brutinel ED, Vakulskas CA, Brady KM, Yahr TL;Molecular microbiology 2008 May; 68(3):657-71 [18373522]
TF
ExsA [P26993, view regulon]
Reported TF sp.
Pseudomonas aeruginosa PAO1
Reported site sp.
Pseudomonas aeruginosa PAO1
Created by
Dinara Sagitova
Curation notes
-

Experimental Process

EMSAs showed that the mobilities of the exsC, exsD and exoT promoter fragments were significantly retarded in the presence of ExsA. DNase I footprinting experiments were performed to map the promoter regions bound by ExsA. Multiple sequence alignment of 10 ExsA-dependent promoters was performed to identify highly conserved bases. To identify the minimal promoter sequence necessary for ExsA binding a series of probes derived from the exoT promoter was generated.

Transcription Factor Binding Sites


CTTAAAAGAAAAGTCTCTCAGTGACAA
CTAAAAATAACTGACGTTTTTTGAAAG
TAAAAAAACCACGGCCAATCCTGATAG
CTTAAAAGAAAAGTCTCTCAGTGACAA
CTAAAAATAACTGACGTTTTTTGAAAG
TAAAAAAACCACGGCCAATCCTGATAG

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
CTTAAAAGAAAAGTCTCTCAGTGACAA
... ... exsC exsE exsB
Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - not specified monomer
CTAAAAATAACTGACGTTTTTTGAAAG
... ... exsA exsD pscB pscC pscD pscE pscF pscG pscH pscI pscJ pscK pscL
Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - not specified monomer
TAAAAAAACCACGGCCAATCCTGATAG
... ... PA0043 exoT
Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - not specified monomer