The electrophoretic mobility shift assay results demonstrated that OxyR may directly regulate the katA gene by binding to the ORE. This was further validated by performing DNase I footprinting experiments. Chromatin immunoprecipitation (ChIP) using an anti-OxyR antibody showed that P. aeruginosa OxyR can bind to the katA promoter region under both noninducing and H2O2-inducing conditions in vivo.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
CAATTTATTAAAGACAGCGAGACGATAGATAAAAACTTTA |
|
not specified | not specified |