The expression levels of ompC and ompF were tested in Δcrp and WT by qRT-PCR and lacZ fusion assays in the presence of 1 mM cAMP. Both methods indicate that CRP positively resulates ompC, ompF. Primer extension assays were also conducted. The results of these assays were consistent with RT-PCR and lacZ experiments. A CRP-consensus like sequences were predicted by scanning a 300bp upstream DNA regions of ompC, F and X, with a CRP-consensus sequence and a cutoff score value of 7. DNase I footprinting with CRP protein in the presence of 2 mM cAMP protected a single distinct region upstream of each target gene against DNase I digestion in a dose-dependent pattern.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
AAACAGTGAGTTATAGCACATAT | ompC, |
|
activator | not specified | |
ACTTTGTGACTTAGATCGAATTT | ompF |
|
activator | not specified |