The authenticity of the putative Vfr binding site was verified by EMSAs and DNase I footprinting. The protected sequence contained the predicted Vfr binding site. A semiquantitative Western analysis showed a lower FleQ production. To further confirm the repression of fleQ by Vfr, fleQ-lacZ fusions were constructed. The results of these fusions showed a two-fold change in fleQ expression in P. aeruginosa PAO1. Site-directed mutagenesis introducing an ACA-to-CGC mutation in the fleQ promoter showed that the activity of the mutated promoter was not repressed by overproduction of Vfr in PAO1, indicating that Vfr was not able to bind to the fleQ promoter in vivo in strain PAO1.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
---|---|---|---|---|---|
AAATTGACTAATCGTTCACATTTG | fleQ, |
|
repressor | not specified |