Curation Information

Publication: Pseudomonas aeruginosa thiol peroxidase protects against hydrogen peroxide toxicity and displays atypical patterns of gene regulation.;Somprasong N, Jittawuttipoka T, Duang-Nkern J, Romsang A, Chaiyen P, Schweizer HP, Vattanaviboon P, Mongkolsuk S;Journal of bacteriology 2012 Aug; 194(15):3904-12 [22609922]
TF: IscR [Q9HXI7, view regulon]
Reported TF sp.: Pseudomonas aeruginosa PAO1
Reported site sp.: Pseudomonas aeruginosa PAO1
Created by: Dinara Sagitova
Curation notes: -

Experimental Process

Using the primer extension analysis, the promoter region of tpx gene was identified. The sequence with a high degree of homology (18/26) to the E. coli IscR consensus binding site was identified at positions -46 to -21 of the tpx promoter. tpx expression was monitored with a WT strain and a iscR knockout mutant. "Northern blot analysis was performed using RNA samples prepared from uninduced and PB-induced iscR mutants, in addition to its complemented strain harboring pIscR plasmid (iscR/pIscR) and a PAO1 strain. As expected, PB-treated PAO1 showed a 6.5-fold induction in tpx expression based on densitometric analysis. The PB induction of tpx expression was abolished in the iscR mutant. The tpx expression showed constitutively high expression levels in the iscR mutant. The uninduced level of tpx transcripts in the iscR mutant was 10.5-fold higher than the uninduced level in PAO1 and 1.4-fold higher than the levels attained in the PB-induced sample from PAO1. In the iscR/pIscR strain, the uninduced tpx transcript level was 0.7-fold lower than the uninduced level in the PAO1 strain. As expected, the exposure to PB induced a 2.5-fold increase in the tpx transcription level. PB-induced tpx expression was restored in the complemented mutant strain." A gel mobility shift assay confirmed specific binding of IscR to the tpx promoter region.

Transcription Factor Binding Sites

Sites reported in the paper
Sites matched in the genome

AAACCCGAGGTTTTCGCTCGGGTAAA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence	Regulated genes	Gene diagram	Experimental techniques	TF function	TF type
AAACCCGAGGTTTTCGCTCGGGTAAA	tpx		Experimental technique details EMSA (ECO:0001807) EMSA - ECO:0001807 Electro-mobility shift-assays (or gel retardation assays) are a standard way of assessing TF-binding. A fragment of DNA of interest is amplified and labeled with a fluorophore. The fragment is left to incubate in a solution containing abundant TF and non-specific DNA (e.g. randomly cleaved DNA from salmon sperm, of all things) and then a gel is run with the incubated sample and a control (sample that has not been in contact with the TF). If the TF has bound the sample, the complex will migrate more slowly than unbound DNA through the gel, and this retarded band can be used as evidence of binding. The unspecific DNA ensures that the binding is specific to the fragment of interest and that any non-specific DNA-binding proteins left-over in the TF purification will bind there, instead of on the fragment of interest. EMSAs are typically carried out in a bunch of fragments, shown as multiple double (control+experiment) lanes in a wide picture. Certain additional controls are run in at least one of the fragments to ascertain specificity. In the most basic of these, specific competitor (the fragment of interest or a known positive control, unlabelled) is added to the reaction. This should sequester the TF and hence make the retardation band disappear, proving that the binding is indeed specific - Experimental technique details Northern blot (ECO:0005653) Northern blot - ECO:0005653 The northern blot is a technique used in molecular biology research to study gene expression by detection of RNA (or isolated mRNA) in a sample. Northern blotting involves the use of electrophoresis to separate RNA samples by size and detection with a hybridization probe complementary to part of or the entire target sequence. - Experimental technique details Visual sequence inspection (nan) Visual sequence inspection - nan Visual inspection of promoter region to identify putative binding sites based on previous knowledge -	repressor	not specified