Curation Information

Publication
The zinc-responsive regulator Zur and its control of the znu gene cluster encoding the ZnuABC zinc uptake system in Escherichia coli.;Patzer SI, Hantke K;The Journal of biological chemistry 2000 Aug 11; 275(32):24321-32 [10816566]
TF
Zur [P0AC51, view regulon]
Reported TF sp.
Escherichia coli str. K-12 substr. MG1655
Reported site sp.
Escherichia coli str. K-12 substr. MG1655
Created by
Dinara Sagitova
Curation notes
-

Experimental Process

Beta-gal reporter assay was used to validate that Zur acts as a repressor. DNA-binding activity of Zur was shown to be metal ion dependent. DNAse I footprinting assays identified a single Zur binding site within znu promoter region.

Transcription Factor Binding Sites


TGAGAAGTGTGATATTATAACATTTCATG
TGAGAAGTGTGATATTATAACATTTCATG

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type